N2Jenomics Lab Pvt. Ltd. offers a high-accuracy Mitochondrial DNA (mtDNA) Copy Number Quantification Service developed exclusively for Research Use Only (RUO) applications. Our validated workflow enables precise and reproducible measurement of mitochondrial DNA copy number, supporting a wide range of studies in molecular biology, drug discovery, translational research, and biomarker development.
Designed for academic institutions, pharmaceutical companies, contract research organizations (CROs), and biotechnology laboratories, our service delivers reliable quantitative data for investigations involving mitochondrial function, cellular metabolism, aging, cancer biology, neurodegenerative disorders, metabolic diseases, and mitochondrial genome dynamics.
By combining optimized molecular assays, stringent quality control procedures, and advanced data analysis, we provide high-quality results with rapid turnaround times. Our workflow is compatible with multiple research sample types and can be tailored to meet the specific objectives of your study, enabling researchers to generate robust, publication-ready data with confidence.
Mitochondrial DNA Copy Number (mtDNA-CN) represents the number of mitochondrial genomes present within a cell and serves as an important indicator of mitochondrial abundance, function, and cellular energy metabolism. Variations in mtDNA-CN have been associated with numerous physiological and pathological conditions, making it a valuable biomarker in biomedical and translational research.
At N2Jenomics Lab Pvt. Ltd., we provide accurate, reproducible, and research-grade mtDNA Copy Number Quantification to support studies across oncology, metabolic disorders, aging, drug development, and mitochondrial biology.
Alterations in mitochondrial DNA copy number have been reported in numerous cancer types, including breast, bladder, kidney, colorectal, and liver cancers. Measuring mtDNA-CN helps researchers investigate tumor biology, identify potential biomarkers, and evaluate therapeutic responses during oncology research.
Changes in mitochondrial content are closely linked to cellular aging and metabolic dysfunction. mtDNA Copy Number Quantification supports studies investigating aging, cardiovascular disease, diabetes, obesity, chronic kidney disease, neurodegenerative disorders, and mitochondrial dysfunction.
Many pharmaceutical compounds can influence mitochondrial function. Monitoring mtDNA copy number enables researchers to evaluate mitochondrial toxicity, assess drug safety, compare candidate compounds, and study cellular responses to environmental or chemical stress.
Quantifying mtDNA copy number provides valuable insights into mitochondrial biogenesis, cellular metabolism, oxidative stress, and disease mechanisms, making it an important tool for biomarker discovery and translational research.
Unlike nuclear DNA, each cell contains numerous mitochondria, and every mitochondrion carries multiple copies of its own genome. Consequently, the total number of mitochondrial DNA molecules varies among different tissues, cell types, and physiological conditions.
Measuring the ratio of mitochondrial DNA to nuclear DNA enables researchers to estimate the average mitochondrial DNA copy number per cell. This measurement serves as a reliable indicator of mitochondrial abundance and overall cellular bioenergetic status.
Among the available analytical methods—including whole genome sequencing (WGS), digital PCR (dPCR), and microarray-based approaches—quantitative PCR (qPCR) remains one of the most widely adopted techniques for mtDNA copy number analysis due to its combination of accuracy, speed, scalability, and cost-effectiveness.
Key advantages include:
N2Jenomics Lab Pvt. Ltd. offers a TaqMan Probe-Based qPCR Assay designed for accurate and reproducible quantification of mitochondrial DNA copy number. The assay simultaneously amplifies mitochondrial DNA and a reference nuclear gene within the same reaction, enabling precise normalization and reliable estimation of mtDNA copy number.
This optimized workflow minimizes experimental variation while delivering consistent, publication-quality results suitable for academic, pharmaceutical, biotechnology, and CRO research projects.
Our assay utilizes TaqMan hydrolysis probe chemistry, which provides exceptional analytical specificity and sensitivity. During PCR amplification, the probe is cleaved only after binding to its complementary DNA target, generating fluorescence proportional to the amount of amplified DNA.
To maximize assay accuracy:
Our optimized workflow delivers reliable quantitative performance across a broad range of research applications.
The assay accurately quantifies mtDNA copy number from low-input DNA samples, making it suitable for precious or limited research specimens.
Optimized reaction conditions and stringent quality control ensure highly reproducible results with minimal technical variation across replicate experiments.
The assay demonstrates excellent linearity over a wide range of DNA concentrations, allowing accurate quantification across diverse sample types and input amounts.
Our assay has been carefully designed to maximize specificity and analytical performance.
The assay simultaneously amplifies mitochondrial DNA and nuclear DNA within a single reaction, reducing technical variability while improving workflow efficiency.
Data analysis supports both:
Our assay is optimized to minimize interference from nuclear mitochondrial DNA sequences (NUMTs) and non-specific amplification.
Quality assurance includes:
• These measures ensure accurate, reproducible, and reliable mtDNA copy number quantification suitable for high-quality research and publication.
Table: Primer Sequences Used in Our mtDNA Copy Number qPCR Assay
| Target Gene | Primer Name | Direction | Sequence (5′ → 3′) | Length (bp) |
|---|---|---|---|---|
| mt-ND1 | mt-ND1-F | Forward | TACGGGCTACTACAACCCTTC | 21 |
| mt-ND1 | mt-ND1-R | Reverse | ATGGTAGATGTGGCGGGTTT | 20 |
| mt-ND5 | mt-ND5-F | Forward | CATTACTAACAACATTTCCCCCGC | 24 |
| mt-ND5 | mt-ND5-R | Reverse | GGCTGTGAGTTTTAGGTAGAGGG | 23 |
| (Control) | SERPINA1-F | Forward | CAGTGAATAAATGAGGCGTACATCC | 25 |
| (Control) | SERPINA1-R | Reverse | GACTGTTTCTCATGCCTCTGGAAAG | 25 |
Note: For mtDNA copy number estimation, mt-ND1 is the primary target. SERPINA1 may serve as a nuclear reference gene (depending on context). No TaqMan probe sequences were listed; if probes are also available, I can include them.
Our streamlined workflow is designed to ensure accurate, reproducible, and high-quality mitochondrial DNA (mtDNA) copy number quantification from sample receipt to final data delivery.
Upon sample arrival, our team performs a comprehensive quality check to ensure suitability for downstream analysis.
Activities include:
For samples requiring DNA isolation, genomic DNA is extracted using validated laboratory protocols optimized to preserve both mitochondrial and nuclear DNA.
Our workflow includes:
Purified DNA is analyzed using our optimized TaqMan Probe-Based Duplex qPCR Assay, which simultaneously quantifies mitochondrial DNA and a single-copy nuclear reference gene within the same reaction.
Quality measures include:
Following amplification, all data undergo comprehensive quality assessment and quantitative analysis using validated analytical workflows.
Analysis includes:
Upon completion of the analysis, clients receive a detailed report containing quantitative results, quality metrics, and supporting documentation.
Deliverables include:

Our Mitochondrial DNA (mtDNA) Copy Number Quantification Service supports a broad range of research applications by providing accurate and reproducible measurement of mitochondrial DNA abundance. This assay is widely used in basic research, translational studies, and drug development to investigate mitochondrial function, cellular metabolism, and disease mechanisms.
Quantify mitochondrial DNA copy number changes between tumor and matched normal tissues to investigate mitochondrial dysfunction, tumor progression, biomarker discovery, and therapeutic response in cancer research.
Monitor changes in mitochondrial DNA copy number associated with aging, cellular senescence, and longevity. The assay also supports studies evaluating the effects of dietary interventions, exercise, pharmaceuticals, and lifestyle modifications on mitochondrial health.
Investigate mtDNA copy number alterations associated with metabolic disorders such as diabetes, obesity, non-alcoholic fatty liver disease (NAFLD), and inherited mitochondrial diseases. The assay provides valuable insights into mitochondrial biogenesis, energy metabolism, and disease pathogenesis.
Assess the impact of environmental pollutants, radiation, heavy metals, industrial chemicals, and other toxic exposures on mitochondrial function by monitoring changes in mitochondrial DNA copy number.
Evaluate mitochondrial toxicity and cellular stress induced by drug candidates, biologics, and chemical compounds during preclinical research. mtDNA copy number analysis serves as an important biomarker for assessing mitochondrial safety and compound-induced cellular responses.
Measure the effects of gene-editing technologies, including CRISPR/Cas9, RNA interference (RNAi), and other functional genomics approaches on mitochondrial biology. The assay is also valuable for validating the impact of small molecules, genetic modifications, and targeted therapies on mitochondrial content and function.
Support biomarker discovery studies by identifying mitochondrial DNA copy number changes associated with disease progression, therapeutic efficacy, and physiological responses. The generated data can be integrated with other genomic, transcriptomic, and proteomic datasets to provide comprehensive biological insights.
Enable large-scale epidemiological and population-based studies investigating the relationship between mitochondrial DNA copy number and health outcomes, disease susceptibility, and environmental influences across diverse populations.
At N2Jenomics Lab Pvt. Ltd., we combine advanced molecular biology expertise with optimized qPCR workflows to deliver accurate, reproducible, and research-ready mitochondrial DNA (mtDNA) copy number analysis. Our commitment to quality, transparency, and scientific excellence ensures reliable results for academic, pharmaceutical, biotechnology, and CRO research projects.
Our mtDNA Copy Number Quantification service utilizes validated duplex TaqMan qPCR assays with carefully optimized primer and probe designs. Every assay undergoes stringent quality control, including amplification performance assessment, calibration standards, and comprehensive data validation to ensure accurate and reproducible results.
Our optimized workflow supports a wide range of biological sample types, including:
This flexibility enables consistent and reliable mtDNA-to-nuclear DNA ratio measurement across diverse research applications and experimental models.
We believe in complete transparency throughout the analytical process. Every project includes a detailed report containing:
Our standardized laboratory procedures and validated analytical pipelines are designed to meet the demands of academic research, biotechnology companies, pharmaceutical organizations, and Contract Research Organizations (CROs). Whether your study focuses on biomarker discovery, drug development, mitochondrial biology, toxicology, or functional genomics, our workflow delivers dependable, high-quality data you can trust.
From project planning through final report delivery, our experienced scientists provide personalized technical guidance and responsive project management. We work closely with every client to optimize study design, ensure smooth project execution, and deliver timely, publication-ready results tailored to their research objectives.
By integrating validated molecular assays, rigorous quality assurance, advanced data analysis, and dedicated scientific expertise, N2Jenomics Lab Pvt. Ltd. provides a dependable mtDNA Copy Number Quantification service that empowers researchers to generate accurate, reproducible, and biologically meaningful results with confidence.
Our Mitochondrial DNA (mtDNA) Copy Number Quantification Service provides comprehensive, research-ready deliverables designed to support downstream analysis, publication, and project documentation.
Receive a detailed PDF report summarizing the complete experimental workflow and assay performance. The report includes:
To ensure complete transparency and facilitate independent analysis, we provide all relevant raw and processed data files, including:
Our reports include assay performance metrics demonstrating analytical reliability, including:
Each project undergoes rigorous quality control before release. Quality metrics may include:
A concise interpretation accompanies the quantitative results, providing biological context and highlighting observed changes in mitochondrial DNA copy number relative to the experimental design or study controls. This summary is intended to support research interpretation and facilitate downstream analyses.
All project deliverables are securely shared through our protected online data portal, ensuring confidential and convenient access to:
Our secure delivery system enables clients to easily access, review, and download project data while maintaining data integrity and confidentiality throughout the process.
| Sample Type | Required Format & Amount | Recommended DNA Input |
|---|---|---|
| Whole blood | EDTA/heparin tubes, 1–5 mL | ≥ 5 ng per qPCR reaction |
| PBMCs | 1–5×10⁶ cells, fresh or frozen | ≥ 5 ng per reaction |
| Tissue (frozen/fresh) | ≥ 10 mg (snap-frozen/RNAlater) | ≥ 5 ng per reaction |
| Cultured cells | ≥ 1×10⁶ cells | ≥ 5 ng per reaction |
| Saliva / buccal swab | Collected in DNA-stabilizing buffer | ≥ 5 ng per reaction |
| Urine / CSF / lavage | 1–5 mL volume | Variable; aim ≥ 5 ng if possible |
| Purified gDNA | A260/280 ≈ 1.8–2.0; low fragmentation | ≥ 0.1 ng per reaction |
Mitochondrial DNA copy number (mtDNA-CN) refers to the average number of mitochondrial genome copies present within a single cell. Since mitochondria are responsible for cellular energy production, mtDNA copy number serves as an important indicator of mitochondrial abundance, biogenesis, and overall cellular health. Changes in mtDNA-CN have been associated with a wide range of research areas, including cancer biology, aging, metabolic disorders, neurodegenerative diseases, and mitochondrial dysfunction.
Quantitative PCR (qPCR) is one of the most established methods for mtDNA copy number analysis because it combines high sensitivity, excellent reproducibility, rapid turnaround, and cost-effectiveness. By simultaneously measuring mitochondrial DNA and a single-copy nuclear reference gene, qPCR enables accurate estimation of the mtDNA-to-nuclear DNA ratio. Its scalability and high-throughput capability make it well suited for academic research, pharmaceutical development, and CRO-based studies.
Our assay is designed to deliver highly reproducible and reliable quantitative results through optimized laboratory procedures and stringent quality-control measures. Every analysis includes technical replicates, validated controls, and comprehensive data review to ensure assay consistency.
Key quality features include:
• The overall accuracy of mtDNA copy number estimation depends on factors such as DNA quality, sample type, and experimental design.
Our mtDNA Copy Number Quantification service supports a wide variety of biological samples, including:
• Each sample type is processed using optimized protocols to ensure high-quality DNA recovery and reliable mtDNA copy number measurement.
Yes. Mitochondrial DNA copy number analysis is widely used in cancer research to investigate mitochondrial alterations associated with tumor development, progression, and therapeutic response. Quantitative mtDNA-CN data can support studies focused on cancer biology, biomarker discovery, disease mechanisms, and translational oncology research.
Our assay has been carefully optimized to minimize amplification of nuclear mitochondrial DNA sequences (NUMTs). We employ validated primer and probe designs targeting conserved mitochondrial genomic regions while using a single-copy nuclear reference gene for normalization. In addition, multiple quality-control procedures—including assay validation, negative controls, and amplification performance assessment—help ensure highly specific and reliable mtDNA quantification.
High-quality DNA generally provides the most accurate and reproducible results. However, our optimized qPCR workflow can accommodate moderately fragmented DNA when sufficient target regions remain intact. Prior to analysis, each sample undergoes quality assessment to evaluate DNA concentration, purity, and suitability for testing. Samples that do not meet established quality criteria may require re-extraction or replacement to ensure dependable results.
Turnaround time depends on the number of samples and project requirements. Most projects are completed within the agreed project timeline, and clients receive a comprehensive report along with raw data files, quality-control metrics, and supporting documentation through our secure online data portal.
No. Our Mitochondrial DNA Copy Number Quantification service is provided exclusively for Research Use Only (RUO). The results are intended to support scientific research, biomarker discovery, drug development, and translational studies, and should not be used for clinical diagnosis, patient management, or therapeutic decision-making unless specifically validated under applicable regulatory requirements.